CRISPResso version 2.3.2
[Command used]:
/opt/conda/bin/CRISPResso -o /var/www/webapps/CRISPRessoWEB/CRISPRessoWEB/static/demo/CRISPRessoBatch_on_batch --name FANCF_BE2 --min_paired_end_reads_overlap 10 --quantification_window_size 20 --base_editor_output --fastp_command fastp --flexiguide_gap_extend_penalty -2 --prime_editing_gap_extend_penalty 0 --plot_window_size 20 --exclude_bp_from_right 15 --flash_command None --exclude_bp_from_left 15 --verbosity 3 --aln_seed_len 10 --n_processes 1 --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC --min_bp_quality_or_N 0 --amplicon_name Reference --flexiguide_homology 80 --needleman_wunsch_gap_extend -2 --prime_editing_pegRNA_extension_quantification_window_size 5 --min_average_read_quality 0 --needleman_wunsch_aln_matrix_loc EDNAFULL --needleman_wunsch_gap_incentive 1 --max_rows_alleles_around_cut_to_plot 50 --prime_editing_gap_open_penalty -50 --place_report_in_output_folder --quantification_window_center -10 --conversion_nuc_from C --conversion_nuc_to T --write_cleaned_report --guide_seq GGAATCCCTTCTGCAGCACC --trimmomatic_command None --prime_editing_pegRNA_scaffold_min_match_length 1 --needleman_wunsch_gap_open -20 --min_frequency_alleles_around_cut_to_plot 0.2 --default_min_aln_score 60 --config_file None --aln_seed_min 2 --max_paired_end_reads_overlap None --flexiguide_seq None --min_single_bp_quality 0 --aln_seed_count 5 --fastq_r1 SRR3305544.fastq.gz --flexiguide_gap_open_penalty -20

[Execution log]:
CRISPRessoPro not installed
Computing quantification windows
Added 0 guides with flexible matching
	Original flexiguides: ['None']
	Found guides: []
	Mismatch locations: []
Aligning sequences...
Finished reading fastq file; 5148 unique reads found of 25000 total reads found 
Processing Reads; 0 Completed out of 5148 Unique Reads
Finished reads; N_TOT_READS: 25000 N_COMPUTED_ALN: 4562 N_CACHED_ALN: 18828 N_COMPUTED_NOTALN: 586 N_CACHED_NOTALN: 1024
Done!
Quantifying indels/substitutions...
Done!
Calculating allele frequencies...
Done!
Saving processed data...
Making Plots...
Plotting read bar plot
Plotting read class pie chart and bar plot
Begin processing plots for amplicon Reference
Plotting nucleotide quilt across amplicon
Plotting nucleotide distribuition around sgRNA GGAATCCCTTCTGCAGCACC for Reference
Plotting indel size distribution for Reference
Plotting frequency deletions/insertions for Reference
Plotting amplication modifications for Reference
Plotting modification frequency for Reference
Plotting quantification window locations for Reference
Plotting position dependent indel for Reference
Plotting substitutions across reference for Reference
Plotting substitution frequency barplot for Reference
Plotting substitution frequency barplot in quantification window for Reference
Plotting allele distribution around cut for Reference
Plotting log2 nucleotide frequency for Reference
Plotting conversion at Cs around the sgRNA GGAATCCCTTCTGCAGCACC for Reference
Plotting non-reference conversion at Cs around the sgRNA GGAATCCCTTCTGCAGCACC for Reference
Plotting scaled non-reference conversion at Cs around the sgRNA GGAATCCCTTCTGCAGCACC for Reference
Done!
Done!
Removing Intermediate files...
 >=1.0% of reads have modifications at the start or end. Total reads: 23390, Irregular reads: 23382.
 >=0.2% of substitutions were outside of the quantification window. Total substitutions: 8269, Substitutions outside window: 4176.
 >=30.0% of modifications were substitutions. This could potentially indicate poor sequencing quality. Total modifications: 10262.0, Substitutions: 8269.
Analysis Complete!
                                                                               
                                        _                                      
                                       '  )                                    
                                       .-'                                     
                                      (____                                    
                                   C)|     \                                   
                                     \     /                                   
                                      \___/                                    

