CRISPResso2

FANCF_untr

Guardrail Warning! >=1.0% of reads have modifications at the start or end. Total reads: 24537, Irregular reads: 24527.

Guardrail Warning! >=0.2% of substitutions were outside of the quantification window. Total substitutions: 5545, Substitutions outside window: 4341.

Guardrail Warning! >=30.0% of modifications were substitutions. This could potentially indicate poor sequencing quality. Total modifications: 8439.0, Substitutions: 5545.

CRISPResso2 run information

Figure 1a: The number of reads in input fastqs, after preprocessing, and after alignment to amplicons.

Data: Mapping statistics

CRISPResso version: 2.3.2

Run completed: 2025-05-22 21:09:12

Amplicon sequence:

CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC

Guide sequence:

GGAATCCCTTCTGCAGCACC

Command used:

CRISPResso -o CRISPRessoBatch_on_batch --name FANCF_untr --fastq_r1 SRR3305546.fastq.gz --min_average_read_quality 0 --fastp_command fastp --needleman_wunsch_gap_incentive 1 --flexiguide_gap_extend_penalty -2 --n_processes 1 --needleman_wunsch_gap_extend -2 --min_frequency_alleles_around_cut_to_plot 0.2 --quantification_window_center -10 --write_cleaned_report --needleman_wunsch_gap_open -20 --exclude_bp_from_left 15 --min_single_bp_quality 0 --aln_seed_len 10 --trimmomatic_command None --min_bp_quality_or_N 0 --flash_command None --place_report_in_output_folder --max_rows_alleles_around_cut_to_plot 50 --aln_seed_min 2 --amplicon_seq CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC --default_min_aln_score 60 --quantification_window_size 20 --flexiguide_homology 80 --conversion_nuc_from C --flexiguide_seq None --prime_editing_pegRNA_scaffold_min_match_length 1 --max_paired_end_reads_overlap None --base_editor_output --prime_editing_pegRNA_extension_quantification_window_size 5 --guide_seq GGAATCCCTTCTGCAGCACC --conversion_nuc_to T --flexiguide_gap_open_penalty -20 --verbosity 3 --min_paired_end_reads_overlap 10 --needleman_wunsch_aln_matrix_loc EDNAFULL --config_file None --aln_seed_count 5 --exclude_bp_from_right 15 --prime_editing_gap_extend_penalty 0 --prime_editing_gap_open_penalty -50 --amplicon_name Reference --plot_window_size 20

Parameters:

allele_plot_pcts_only_for_assigned_reference: False
aln_seed_count: 5
aln_seed_len: 10
aln_seed_min: 2
amplicon_min_alignment_score: 
amplicon_name: Reference
amplicon_seq: CATTGCAGAGAGGCGTATCATTTCGCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCC
annotate_wildtype_allele: 
assign_ambiguous_alignments_to_first_reference: False
auto: False
bam_chr_loc: 
bam_input: 
bam_output: False
base_editor_output: True
bowtie2_index: 
coding_seq: 
config_file: None
conversion_nuc_from: C
conversion_nuc_to: T
crispresso1_mode: False
debug: False
default_min_aln_score: 60
disable_guardrails: False
discard_guide_positions_overhanging_amplicon_edge: False
discard_indel_reads: False
dsODN: 
dump: False
exclude_bp_from_left: 15
exclude_bp_from_right: 15
expand_allele_plots_by_quantification: False
expand_ambiguous_alignments: False
expected_hdr_amplicon_seq: 
fastp_command: fastp
fastp_options_string: 
fastq_output: False
fastq_r1: SRR3305546.fastq.gz
fastq_r2: 
file_prefix: 
flash_command: None
flexiguide_gap_extend_penalty: -2
flexiguide_gap_open_penalty: -20
flexiguide_homology: 80
flexiguide_name: 
flexiguide_seq: None
force_merge_pairs: False
guide_name: 
guide_seq: GGAATCCCTTCTGCAGCACC
halt_on_plot_fail: False
ignore_deletions: False
ignore_insertions: False
ignore_substitutions: False
keep_intermediate: False
max_paired_end_reads_overlap: None
max_rows_alleles_around_cut_to_plot: 50
min_average_read_quality: 0
min_bp_quality_or_N: 0
min_frequency_alleles_around_cut_to_plot: 0.2
min_paired_end_reads_overlap: 10
min_single_bp_quality: 0
n_processes: 1
name: FANCF_untr
needleman_wunsch_aln_matrix_loc: EDNAFULL
needleman_wunsch_gap_extend: -2
needleman_wunsch_gap_incentive: 1
needleman_wunsch_gap_open: -20
no_rerun: False
output_folder: CRISPRessoBatch_on_batch
place_report_in_output_folder: True
plot_histogram_outliers: False
plot_window_size: 20
prime_editing_gap_extend_penalty: 0
prime_editing_gap_open_penalty: -50
prime_editing_nicking_guide_seq: 
prime_editing_override_prime_edited_ref_seq: 
prime_editing_override_sequence_checks: False
prime_editing_pegRNA_extension_quantification_window_size: 5
prime_editing_pegRNA_extension_seq: 
prime_editing_pegRNA_scaffold_min_match_length: 1
prime_editing_pegRNA_scaffold_seq: 
prime_editing_pegRNA_spacer_seq: 
quantification_window_center: -10
quantification_window_coordinates: None
quantification_window_size: 20
samtools_exclude_flags: 0
save_also_png: False
split_interleaved_input: False
stringent_flash_merging: False
suppress_amplicon_name_truncation: False
suppress_plots: False
suppress_report: False
trim_sequences: False
trimmomatic_command: None
trimmomatic_options_string: 
use_legacy_insertion_quantification: False
use_matplotlib: False
verbosity: 3
write_cleaned_report: True
write_detailed_allele_table: False
zip_output: False

Running log

Allele assignments

Figure 1b: Alignment and editing frequency of reads as determined by the percentage and number of sequence reads showing unmodified and modified alleles.

Data: Quantification of editing

Figure 1c: Alignment and editing frequency of reads as determined by the percentage and number of sequence reads showing unmodified and modified alleles.

Data: Quantification of editing

Nucleotide composition

Hover your mouse over the bottom image to zoom in on a specific region.
Figure 2a: Nucleotide distribution across amplicon. At each base in the reference amplicon, the percentage of each base as observed in sequencing reads is shown (A = green; C = orange; G = yellow; T = purple). Black bars show the percentage of reads for which that base was deleted. Brown bars between bases show the percentage of reads having an insertion at that position.

Data: Nucleotide frequency table

Figure 2b: Nucleotide distribution around the sgRNA GGAATCCCTTCTGCAGCACC.

Data: Nucleotide frequency in quantification window

Modification lengths

Figure 3a: Frequency distribution of alleles with indels (blue) and without indels (red). Note that histograms are clipped to show 99% of the data. To show all data, run using the parameter '--plot_histogram_outliers'. (Maximum 47 not shown) (Minimum -53 not shown)

Data: Indel histogram

Figure 3b: Left panel, frequency distribution of sequence modifications that increase read length with respect to the reference amplicon, classified as insertions (positive indel size). Middle panel, frequency distribution of sequence modifications that reduce read length with respect to the reference amplicon, classified as deletions (negative indel size). Right panel, frequency distribution of sequence modifications that do not alter read length with respect to the reference amplicon, which are classified as substitutions (number of substituted positions shown).

Data: Insertions frequency

Data: Deletions Frequency

Data: Substitutions Frequency

Indel characterization

Figure 4a: Combined frequency of any modification across the amplicon. Modifications outside of the quantification window are also shown.

Figure 4b: Frequency of insertions, deletions, and substitutions across the entire amplicon, including modifications outside of the quantification window.

Data: Modification frequency

Figure 4c: Frequency of insertions, deletions, and substitutions across the entire amplicon, considering only modifications that overlap with the quantification window.

Data: Modification frequency in quantification window

Figure 4d: Position dependent insertion size(left) and deletion size (right), including only modifications that overlap with the quantification window.

Allele plots

Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.

Data: Allele frequency table

Base editing

Figure 10a: Substitution frequencies across the amplicon.

Data: Nucleotide frequencies

Figure 10b: Substitution frequencies across the amplicon.

Data: Nucleotide frequencies

Figure 10c: Substitution frequencies in the quantification window

Data: Nucleotide frequencies in quantification window

Figure 10d: Log2 nucleotide frequencies for each position in the plotting window around the sgRNA GGAATCCCTTCTGCAGCACC. The quantification window is outlined by the dotted box.

Figure 10e: Proportion of each base at each nucleotide targeted by base editors in the plotting window around the sgRNA GGAATCCCTTCTGCAGCACC. The number of each target base is annotated on the reference sequence at the bottom of the plot.

Data: Nucleotide frequencies at Cs

Figure 10f: Non-reference base proportions. For target nucleotides in the plotting window, this plot shows the proportion of non-reference (non-C) bases as a percentage of all non-reference sequences. The number of each target base is annotated on the reference sequence at the bottom of the plot.

Data: Nucleotide frequencies at Cs

Figure 10g: Non-reference base counts. For target nucleotides in the plotting window, this plot shows the number of non-reference (non-C) bases. The number of each target base is annotated on the reference sequence at the bottom of the plot.

Data: Nucleotide frequencies at Cs

CRISPResso2

Analysis of genome editing outcomes from deep sequencing data

FANCF_untr

CRISPResso2 run information

Allele assignments

Nucleotide composition

Modification lengths

Indel characterization

Allele plots

Base editing