CRISPResso version 2.3.2 [Command used]: /opt/conda/bin/CRISPResso -r1 nhej.r1.fastq.gz -r2 nhej.r2.fastq.gz -a AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej --write_cleaned_report --place_report_in_output_folder [Execution log]: CRISPRessoPro not installed Computing quantification windows Added 0 guides with flexible matching Original flexiguides: ['None'] Found guides: [] Mismatch locations: [] Processing sequences with fastp... Read1 before filtering: total reads: 25000 total bases: 3203270 Q20 bases: 3107259(97.0027%) Q30 bases: 3093007(96.5578%) Read2 before filtering: total reads: 25000 total bases: 3198956 Q20 bases: 3063300(95.7594%) Q30 bases: 3045686(95.2087%) Merged and filtered: total reads: 24554 total bases: 3129999 Q20 bases: 3057250(97.6758%) Q30 bases: 3045067(97.2865%) Filtering result: reads passed filter: 50000 reads failed due to low quality: 0 reads failed due to too many N: 0 reads corrected by overlap analysis: 1086 bases corrected by overlap analysis: 1718 Duplication rate: 79.36% Insert size peak (evaluated by paired-end reads): 133 Read pairs merged: 24554 % of original read pairs: 98.216% % in reads after filtering: 100% JSON report: CRISPResso_on_nhej/fastp_report.json HTML report: CRISPResso_on_nhej/fastp_report.html fastp -i nhej.r1.fastq.gz -I nhej.r2.fastq.gz --merge --merged_out CRISPResso_on_nhej/out.extendedFrags.fastq.gz --unpaired1 CRISPResso_on_nhej/out.notCombined_1.fastq.gz --unpaired2 CRISPResso_on_nhej/out.notCombined_2.fastq.gz --overlap_len_require 10 --thread 1 --json CRISPResso_on_nhej/fastp_report.json --html CRISPResso_on_nhej/fastp_report.html --disable_adapter_trimming --disable_trim_poly_g --disable_quality_filtering --disable_length_filtering fastp v0.24.0, time used: 2 seconds Done! Done! Aligning sequences... Finished reading fastq file; 3460 unique reads found of 24554 total reads found Processing Reads; 0 Completed out of 3460 Unique Reads Finished reads; N_TOT_READS: 24554 N_COMPUTED_ALN: 3355 N_CACHED_ALN: 20989 N_COMPUTED_NOTALN: 105 N_CACHED_NOTALN: 105 Done! Quantifying indels/substitutions... Done! Calculating allele frequencies... Done! Saving processed data... Making Plots... Plotting read bar plot Plotting read class pie chart and bar plot Begin processing plots for amplicon Reference Plotting nucleotide quilt across amplicon Plotting indel size distribution for Reference Plotting frequency deletions/insertions for Reference Plotting amplication modifications for Reference Plotting modification frequency for Reference Plotting quantification window locations for Reference Plotting position dependent indel for Reference Done! Done! Removing Intermediate files... >=1.0% of reads have modifications at the start or end. Total reads: 24344, Irregular reads: 458. >=0.2% of substitutions were outside of the quantification window. Total substitutions: 9093, Substitutions outside window: 1051. Analysis Complete! _ ' ) .-' (____ C)| \ \ / \___/